View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_high_30 (Length: 277)
Name: NF9001_high_30
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 35 - 261
Target Start/End: Complemental strand, 41345040 - 41344814
Alignment:
| Q |
35 |
ccatcctagcatggttgacagcttgcaaggaaattgatgaagggacccaggtgcgttaccatgatggggaaaaaccgataacaggtcgaattttcaatgg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345040 |
ccatcctagcatggttgacagcttgcaaggaaattgatgaagggacccaggtgcgttaccatgatggggaaaaaccgataacaggtcgaattttcaatgg |
41344941 |
T |
 |
| Q |
135 |
agccatcttatgtagctgttgcgacgaggaaatctctgtatggaagtttgagaagcatgctcaaagtgaggatatacaaccatacaaacgcattttggtg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41344940 |
agccatcttatgtagctgttgcgacgaggaaatctctgtatggaagtttgagaagcatgctcaaagtgaggatatacaaccatacaaacgcattttggtg |
41344841 |
T |
 |
| Q |
235 |
gcgacacggaagtccgtcctccaaaac |
261 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41344840 |
gcgacacggaagtccgtcctccaaaac |
41344814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 223
Target Start/End: Original strand, 9994082 - 9994134
Alignment:
| Q |
171 |
tgtatggaagtttgagaagcatgctcaaagtgaggatatacaaccatacaaac |
223 |
Q |
| |
|
||||||||| ||||||| ||| | ||||||||||||||| |||||||| |||| |
|
|
| T |
9994082 |
tgtatggaactttgagatgcacgttcaaagtgaggatatgcaaccatagaaac |
9994134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University