View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9001_low_103 (Length: 210)

Name: NF9001_low_103
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9001_low_103
NF9001_low_103
[»] chr3 (2 HSPs)
chr3 (72-193)||(4264322-4264443)
chr3 (20-82)||(4271352-4271414)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 72 - 193
Target Start/End: Complemental strand, 4264443 - 4264322
Alignment:
72 ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4264443 ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta 4264344  T
172 tctccgcttcaatctctctact 193  Q
    ||||||||||||||||||||||    
4264343 tctccgcttcaatctctctact 4264322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 4271414 - 4271352
Alignment:
20 tagatacatttgccatatccctagaaatggggatgcagtagttaaatacagtttttggaggga 82  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||    
4271414 tagatacatttgccatatccctagaaatgggaatgcagcagttaaatacagtttttggaggga 4271352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University