View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_104 (Length: 210)
Name: NF9001_low_104
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_104 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 10530369 - 10530263
Alignment:
| Q |
1 |
tctaatgtttattagagcaatattttaatgattgtgagtaataattgaccatggaccacagttcgctctagaagccgacgttgtctatttgttcttactg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10530369 |
tctaatgtttattagagcaatattttaatgattgtgagtaataatcgaccgtggaccacagtttgctctagaagccgacgctgtctatttgttcttactg |
10530270 |
T |
|
| Q |
101 |
actcgac |
107 |
Q |
| |
|
||||||| |
|
|
| T |
10530269 |
actcgac |
10530263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 10530233 - 10530189
Alignment:
| Q |
151 |
tttgagtcgatgtgttatcccatacttgtttagttggttaaaact |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10530233 |
tttgagtcgatgtgttatcccatacttgtttagttggttaaaact |
10530189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University