View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_105 (Length: 210)
Name: NF9001_low_105
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_105 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 72 - 193
Target Start/End: Complemental strand, 4264443 - 4264322
Alignment:
| Q |
72 |
ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264443 |
ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta |
4264344 |
T |
|
| Q |
172 |
tctccgcttcaatctctctact |
193 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4264343 |
tctccgcttcaatctctctact |
4264322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 4271414 - 4271352
Alignment:
| Q |
20 |
tagatacatttgccatatccctagaaatggggatgcagtagttaaatacagtttttggaggga |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
4271414 |
tagatacatttgccatatccctagaaatgggaatgcagcagttaaatacagtttttggaggga |
4271352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University