View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_106 (Length: 207)
Name: NF9001_low_106
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_106 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 51183 - 51314
Alignment:
| Q |
19 |
agtagatagtaaagtgataaaaccaatgattgttatatcaacaaactaatgattttttatgacggggcctctaatatcaatcattgatat-------att |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51183 |
agtagatagtaaagtgataaaaccaatgattgttatatcaacaaactaatgatttgttatgacggggcctctaatatcaatcattgatatattcataatt |
51282 |
T |
|
| Q |
112 |
catcaatgatcaatattactttaaactctaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51283 |
catcaatgatcaatattactttaaactctaaa |
51314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University