View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_24 (Length: 440)
Name: NF9001_low_24
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 353; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 8 - 400
Target Start/End: Complemental strand, 49160511 - 49160128
Alignment:
| Q |
8 |
ttggtgttggaggttgcacaacatatgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgttagagggtggcgtgttctcaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49160511 |
ttggtgttggaggttgcacaacatatgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgttagagggtggcgtgttctcaaca |
49160412 |
T |
|
| Q |
108 |
ccggctcccctatcagtgtaaatacttactcacttgctgcaatttattcatatttctttggttaaatgtcattccaatctatatatgatatatcaccatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49160411 |
ccggctcccctatcagtgtaaatacttactcacttgctgcaatttattcatatttctttggttaaatgtcattccaatctatatatgatatatcaccatc |
49160312 |
T |
|
| Q |
208 |
atcttagttccaagaagtagacacatttttacattcaatcacttatattgtctgtgtctatagttcgatatgtttcataaccttcgtttggtgtaaaaca |
307 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49160311 |
atcttagatccaagaagtagacacatttttacattcaatcacttatattgtctgtgtctatagttcgatatgtttcataaccttcgtttggtgtaaaaca |
49160212 |
T |
|
| Q |
308 |
taaaatgacttcacaatttcaaatgtttcaatttctatttagattgagataaaaacaactttatatgttgttttgtgtgaacatatatacata |
400 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49160211 |
taaaatgacttcacaatt---------tcaatttctatttagattgagataaaaacaactttatatgttgctttgtgtgaacatatatacata |
49160128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 2 - 131
Target Start/End: Complemental strand, 49156342 - 49156213
Alignment:
| Q |
2 |
tcgagtttggtgttggaggttgcacaacatatgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgttagagggtggcgtgttc |
101 |
Q |
| |
|
||||| ||||||||||| ||||| || ||| |||||||||||||||||||||| |||||||||||||| |||||||| |||||| | || |||||||||| |
|
|
| T |
49156342 |
tcgagattggtgttggaagttgctcagcatttgggtgaaggtgttgtgagaacgattgctatggatgctactgaaggtgttgttcgtggatggcgtgttc |
49156243 |
T |
|
| Q |
102 |
tcaacaccggctcccctatcagtgtaaata |
131 |
Q |
| |
|
| |||||||| || || ||||||||||||| |
|
|
| T |
49156242 |
ttaacaccggttctcccatcagtgtaaata |
49156213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 8 - 131
Target Start/End: Original strand, 27958056 - 27958179
Alignment:
| Q |
8 |
ttggtgttggaggttgcacaacatatgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgttagagggtggcgtgttctcaaca |
107 |
Q |
| |
|
||||| |||||||||||| | ||| ||||||| || || ||| |||| ||||||||| | | ||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
27958056 |
ttggtcttggaggttgcagatcatttgggtgagggcgtggtgcgaacaattgctatgagtccaactgaaggagttgctagagggtggcgagtgctcaaca |
27958155 |
T |
|
| Q |
108 |
ccggctcccctatcagtgtaaata |
131 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
27958156 |
ccggctcccctatcactgtaaata |
27958179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 45639322 - 45639271
Alignment:
| Q |
33 |
tgggtgaaggtgttgtgagaactattgctatggatgccactgaaggagttgt |
84 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
45639322 |
tgggtgaaggtgttgtgagaaccattgctatggatgctactgaaggtgttgt |
45639271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University