View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_59 (Length: 332)
Name: NF9001_low_59
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_59 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 228 - 332
Target Start/End: Complemental strand, 1623746 - 1623642
Alignment:
| Q |
228 |
ccctaaaagaatggaagaactattcgcttgacggtctggatatgaattaccagtcggagatccatccacatattatagatcatgtccataaaaattccaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1623746 |
ccctaaaagaatggaagaactattcgcttgacggtctggatatgaattaccagtcggaggtccatccacatattatagatcatgtccataaaaattccaa |
1623647 |
T |
 |
| Q |
328 |
aagca |
332 |
Q |
| |
|
||||| |
|
|
| T |
1623646 |
aagca |
1623642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 10 - 120
Target Start/End: Complemental strand, 15198289 - 15198180
Alignment:
| Q |
10 |
aattagaagaaaagggtaaatttgggaattgagaaaatgtggcatttctcccttcatttctttcctaatgagcgaagattgctaaaagcaatgggtccca |
109 |
Q |
| |
|
||||||||||||||||||||||| || || |||||||||| ||||| |||||||||||| ||||| || |||| |||||||||| |||| |||||| |
|
|
| T |
15198289 |
aattagaagaaaagggtaaatttttaaaatgcaaaaatgtggcctttctaccttcatttcttccctaaccagtgaagtttgctaaaag-aatgtgtccca |
15198191 |
T |
 |
| Q |
110 |
ccacttttgta |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
15198190 |
ccacttttgta |
15198180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University