View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9001_low_60 (Length: 332)

Name: NF9001_low_60
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9001_low_60
NF9001_low_60
[»] chr2 (1 HSPs)
chr2 (228-332)||(1623642-1623746)
[»] chr3 (1 HSPs)
chr3 (10-120)||(15198180-15198289)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 228 - 332
Target Start/End: Complemental strand, 1623746 - 1623642
Alignment:
228 ccctaaaagaatggaagaactattcgcttgacggtctggatatgaattaccagtcggagatccatccacatattatagatcatgtccataaaaattccaa 327  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
1623746 ccctaaaagaatggaagaactattcgcttgacggtctggatatgaattaccagtcggaggtccatccacatattatagatcatgtccataaaaattccaa 1623647  T
328 aagca 332  Q
    |||||    
1623646 aagca 1623642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 10 - 120
Target Start/End: Complemental strand, 15198289 - 15198180
Alignment:
10 aattagaagaaaagggtaaatttgggaattgagaaaatgtggcatttctcccttcatttctttcctaatgagcgaagattgctaaaagcaatgggtccca 109  Q
    |||||||||||||||||||||||   || ||  |||||||||| ||||| |||||||||||| |||||  || |||| |||||||||| |||| ||||||    
15198289 aattagaagaaaagggtaaatttttaaaatgcaaaaatgtggcctttctaccttcatttcttccctaaccagtgaagtttgctaaaag-aatgtgtccca 15198191  T
110 ccacttttgta 120  Q
    |||||||||||    
15198190 ccacttttgta 15198180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University