View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_64 (Length: 318)
Name: NF9001_low_64
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 141 - 312
Target Start/End: Complemental strand, 45067123 - 45066952
Alignment:
| Q |
141 |
gcaatgaatgatgggtacctaccgtggagagatccagtgaggagaagaatgtctttagcgacggaaataacttcaggacctatgccgtcgccgggaagga |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45067123 |
gcaatgaatgatgggtacctaccgtggagagatccagtgaggagaagaatgtctttagcgacggaaataacttcaggacctatgccgtcgccgggaagga |
45067024 |
T |
 |
| Q |
241 |
gagtgattttgtaggagcgttttgaagaagggacggtggcggaacatcgtagggaggttcgttttgatgatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45067023 |
gagtgattttgtaggagcgttttgaagaagggacggtggcggaacatcgtagggaggttcgttttgatgatg |
45066952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 45067263 - 45067184
Alignment:
| Q |
1 |
tcaggtaaaggaacaccagtagcatcaagtgcagcaccacccaaaagcttctcttgaaactcaagcttaatccctaattc |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45067263 |
tcaggtaaaggaacaccagtagcatcaagtgcagcaccacccaaaagcttctcttgaaactcaagcttaatccctaattc |
45067184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University