View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_71 (Length: 304)
Name: NF9001_low_71
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 154 - 286
Target Start/End: Complemental strand, 40599011 - 40598879
Alignment:
| Q |
154 |
ttgctgtaattttttcaatttataggcagaagattaatgtctgtatctcacgagacaacaccaactaatgtcttattaaatttgatgtagtacacaatag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40599011 |
ttgctgtaattttttcaatttataggcagaagattaatgtctgtatctcacgagacaacaccaactaatgtcttattaaatttgatgtagtacacaatag |
40598912 |
T |
|
| Q |
254 |
aaacaaaaaacactattgctccattgtaactac |
286 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
40598911 |
aaacaaaaaacactattactccattgtaactac |
40598879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 40599148 - 40599063
Alignment:
| Q |
2 |
taggagctaaccatatgggacctcttgtgatggtgcatgagttgctgccttatttgaatctctctacatcgttttatcggatgtag |
87 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40599148 |
taggagctaaccatttgggacctcttgtgatggtgcatgagttgctgccttatttgaatctctctacatcgttttatcggatgtag |
40599063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University