View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_81 (Length: 276)
Name: NF9001_low_81
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 6265718 - 6265976
Alignment:
| Q |
1 |
tgtcgcagcgttaaaatattaatcacgacattgcagaaatcttaataaaataagttgaaatacctggcattggcaatactgaaacttgtttctcaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6265718 |
tgtcgcagcgttaaaatattaatcacaaaattgcagaaatcttaataaaataatttgaaatacctggcattggcaatactgaaacttgtttctcaaaatt |
6265817 |
T |
 |
| Q |
101 |
ttcactgctcgaatccttttcctcttcgacttcacttccatctcgactagtacaatcacatgaagaaacttcctcaatcggcaattccatcaatgactcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6265818 |
ttcactgctcgaatccttttcctcttcgacttcacttccatctcgactagtacaatcacatgaagaaacttcctcaatcggcaattccatggatgactcc |
6265917 |
T |
 |
| Q |
201 |
ataacactactgctagagttgctctctagaccatgttcttcatccaaatctaccaaaat |
259 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6265918 |
ataacactactgctagaattgctctctagaccatgttcttcatccaaatcaaccaaaat |
6265976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University