View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_84 (Length: 270)
Name: NF9001_low_84
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_84 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 270
Target Start/End: Complemental strand, 30505267 - 30505013
Alignment:
| Q |
16 |
acatcaaacttaacgaacttacttttcccgctaccgccctgttgctccttactaggccccttacccaagctcaccgtcacgtcaccaacctgaacattat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30505267 |
acatcaaacttaacgaacttacttttcccgctaccgccctgttgctccttactatgccccttacccaagctcaccgtcacgtcaccaacctgaacgttat |
30505168 |
T |
|
| Q |
116 |
ccaacgcacccactcttgcttgtggcacccgtccctctagtccatccgattgaccttcaacagctttcgatccagcttccatcacatcaccctcaacaac |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30505167 |
ccaacgcacccactctggcttgtggcacccgtccctctagtccatccgattggccttcaacagctttcgatccagcttccatcacatcaccctcaacaac |
30505068 |
T |
|
| Q |
216 |
tgatttaactcccttaccaaccttaacacctcctcccgcggtatccttcgcaccc |
270 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30505067 |
tgatttaactcccttaccgaccttaacacctcctcccgcggtatccttcgcaccc |
30505013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 270
Target Start/End: Complemental strand, 30545610 - 30545356
Alignment:
| Q |
16 |
acatcaaacttaacgaacttacttttcccgctaccgccctgttgctccttactaggccccttacccaagctcaccgtcacgtcaccaacctgaacattat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30545610 |
acatcaaacttaacgaacttacttttcccgctaccgccctgttgctccttactatgccccttacccaagctcaccgtcacgtcaccaacctgaacgttat |
30545511 |
T |
|
| Q |
116 |
ccaacgcacccactcttgcttgtggcacccgtccctctagtccatccgattgaccttcaacagctttcgatccagcttccatcacatcaccctcaacaac |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30545510 |
ccaacgcacccactctggcttgtggcacccgtccctctagtccatccgattggccttcaacagctttcgatccagcttccatcacatcaccctcaacaac |
30545411 |
T |
|
| Q |
216 |
tgatttaactcccttaccaaccttaacacctcctcccgcggtatccttcgcaccc |
270 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30545410 |
tgatttaactcccttaccgaccttaacacctcctcccgcggtatccttcgcaccc |
30545356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University