View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_94 (Length: 221)
Name: NF9001_low_94
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_94 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40225049 - 40224829
Alignment:
| Q |
1 |
ctcctccgccgctgattacagcaatgttttcgccgctatccatcgtcggagactccattggatccaaatccttcagatgcagaagtatcactccattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225049 |
ctcctccgccgctgattacagcaatgttttcgccgctatccatcgtcggagactccattggatccaaatccttcagatgcagaagtatcactccattgct |
40224950 |
T |
|
| Q |
101 |
gatgtcgctcttcagcttaaaatagtagctgacnnnnnnnntaccgttgaggaggttattcaaaacgacatcgttgtgatggaagaggaggaacagaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224949 |
gatgtcgctcttcagcttaaaacagtagctgacaaaaaaaataccgttgaggaggttattcaaaacgacatcgttgtgatggaagaggaggaacagaaaa |
40224850 |
T |
|
| Q |
201 |
cagaggagaaagtgatcgacg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40224849 |
cagaggagaaagtgatcgacg |
40224829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 2 - 122
Target Start/End: Original strand, 51588154 - 51588274
Alignment:
| Q |
2 |
tcctccgccgctgattacagcaatgttttcgccgctatccatcgtcggagactccattggatccaaatccttcagatgcagaagtatcactccattgctg |
101 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
51588154 |
tcctccgccgttgattacatcaatgttttcgcccctatccatcgtcgtagactccattggatccaaatctttcagatgcagaagtatcattccatagctg |
51588253 |
T |
|
| Q |
102 |
atgtcgctcttcagcttaaaa |
122 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
51588254 |
atgtcgctcttcagctaaaaa |
51588274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University