View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_96 (Length: 217)
Name: NF9001_low_96
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 21269376 - 21269207
Alignment:
| Q |
1 |
aatgcatcttctattatctactagtatatcatacagctgttgcagctgtactttgtaagggcgatgcttcctttgttaatacaattatgagtggttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269376 |
aatgcatcttctattatctactagtatatcatacagctgttgcagctgtactttgtaagggcgatgcttcctttgttaatacaattatgagtggttttat |
21269277 |
T |
 |
| Q |
101 |
aatatttatgcctgtgaaagcttatactcgtttgtcttgagcttgtttagctctgaagtatttattggat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269276 |
aatatttatgcctgtgaaagcttatactcatttgtcttgagcttgtttagctctgaagtatttattggat |
21269207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 21291497 - 21291418
Alignment:
| Q |
15 |
tatctactagtatatcatacagctgttgcagctgtactttgtaagggcgatgcttcctttgttaatacaattatgagtgg |
94 |
Q |
| |
|
||||| |||| |||||||||||| ||| ||||| ||||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
21291497 |
tatctgctagcatatcatacagccattgaagctggactttgtaaaggcgatgtttcctttgttaatatggttatgagtgg |
21291418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University