View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9001_low_99 (Length: 213)
Name: NF9001_low_99
Description: NF9001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9001_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 6 - 199
Target Start/End: Original strand, 24345187 - 24345392
Alignment:
| Q |
6 |
agatgaccttagcttgattagtcacatttaagaacatggtcatgcaatcagtttgttgataagaaaaaaccaacatgttattggcatcctactggtgcat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24345187 |
agatgaccttagcttgattagtcacatttaagaacatggtcatgcaatcagtttgttgataagaaaaaaccaacatgttattggcatccaactggtgcat |
24345286 |
T |
 |
| Q |
106 |
agctgccatttgcttcacct------------aaaaaagcattcaatctcatggtatcacataatgtttatttgttactccctcgttgtattttattagg |
193 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24345287 |
agctgccatttgcttcacctaaaaaagcaaaaaaaaaagcattcaatctcatggtatcacataatgtttatttgttactccctcgttgtattttattagg |
24345386 |
T |
 |
| Q |
194 |
gtatgt |
199 |
Q |
| |
|
|||||| |
|
|
| T |
24345387 |
gtatgt |
24345392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University