View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9003_high_25 (Length: 272)
Name: NF9003_high_25
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9003_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 17 - 134
Target Start/End: Complemental strand, 15170121 - 15170007
Alignment:
| Q |
17 |
gagaaggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttggattgtgnnnnnnnnnactgttggtttggagtgtt |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
15170121 |
gagatggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttgaattgtgtttctttttac---tggtttggagtgtt |
15170025 |
T |
 |
| Q |
117 |
tgaaaatttctcttctcc |
134 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
15170024 |
tgaaaatttctcttctcc |
15170007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 253
Target Start/End: Complemental strand, 15170007 - 15169916
Alignment:
| Q |
163 |
cagttaacggctgctccgtacccaacggcagttaatttttgttgtcctagcg-cagttaattgttgttacgttcttttcaagcataactagc |
253 |
Q |
| |
|
|||||||| |||||| ||| ||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15170007 |
cagttaactgctgctttgtatccaacggcaattaattttggttgtcctagcggcagttaattgttgttacgttcttttcaagcataactagc |
15169916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University