View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9003_high_34 (Length: 231)
Name: NF9003_high_34
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9003_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 131 - 201
Target Start/End: Original strand, 9364966 - 9365036
Alignment:
| Q |
131 |
attttgagttttgatttcccaaattaatgataagagacatccgatctctatctaaccatgaaaatggacaa |
201 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
9364966 |
attttgagttttaatttctcaaattcatgataagagacatccgatctctatctaaccgtgaagatggacaa |
9365036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 9364839 - 9364891
Alignment:
| Q |
15 |
tggtgttcgacctcgacccaaaactgacacatatgattacatttaattattta |
67 |
Q |
| |
|
||||||||||| | ||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9364839 |
tggtgttcgacttagacaaaaaattgacacatatgattacaattaattattta |
9364891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University