View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9003_low_44 (Length: 313)
Name: NF9003_low_44
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9003_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 23 - 289
Target Start/End: Complemental strand, 46506213 - 46505948
Alignment:
| Q |
23 |
cttaaaatagtatctttgtgtgcacttgttagcaagacactataaagtgcgtaacataaactcggtaaataaaatatattgagatagagtaaatgtaatt |
122 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46506213 |
cttaaaagagtatctt-gtgagcacttgttagcaagacactataaagtgcgtaacataaactcggtaaataaagtatattgagatagagtaaatgtaatt |
46506115 |
T |
 |
| Q |
123 |
ccaaacatggtatgattcgttagtttaccaattggttatgaggaatcatctgcaaataaagagattcacccatcacaatcacaaggaaagaatttggtac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46506114 |
ccaaacatggtatgattcgttagtttaccaattggttatgaggaatcatctgcaaataaagagattcacccatcacaatcacaaggaaagaatttggtac |
46506015 |
T |
 |
| Q |
223 |
attggaattgtttgtgcatgaaatttcaacaagtcattggctgaaatgtagtgggtgaatctcaaac |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46506014 |
attggaattgtttgtgcatgaaatttcaacaagtcattggctgaaatgtagtgggggaatctcaaac |
46505948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University