View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9003_low_57 (Length: 275)
Name: NF9003_low_57
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9003_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 51349628 - 51349401
Alignment:
| Q |
10 |
ctatgtgaaatgggaccactgccaacgttacgcgtgtagcctcttgttaccacctttcggcgtgtgctgccgccgttatgggggaataaagagaaaaaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51349628 |
ctatgtgaaatgggaccactgccaacgttacgcgtgtagcctcttgttaccacctttcggcgtgtgctgccgccgttatggg--aataaagagaaaaaca |
51349531 |
T |
 |
| Q |
110 |
ttctcatcgcccaccgtgccactttcccctctccctcttgctgctaatcttctcaattcttccactaagctttaccaattttaatttctcatcatgtgcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51349530 |
ttctcatcgcccaccgtgccactttcccctctccctcttgctactaatcttctcaattctcccactaagctttaccaattttaatttctcatcatgtgcg |
51349431 |
T |
 |
| Q |
210 |
taaatgccatggatgttgaagaatcatctc |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
51349430 |
taaatgccatggatgttaaagaatcatctc |
51349401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University