View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9003_low_75 (Length: 252)
Name: NF9003_low_75
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9003_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 177
Target Start/End: Complemental strand, 33521666 - 33521505
Alignment:
| Q |
16 |
acattcttttcttataattaaggttgaagggagtatcggttcttagaggacttacgataagtctatgactctatgttatggtctatgtgagctctagtga |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||| |||||||| || || ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33521666 |
acatttttttcttataattaaggttgaagggagtatcggtccttaaaggacttatgacaaatctatgactctatgttatggtctgtgtgagctctagtga |
33521567 |
T |
|
| Q |
116 |
cttagggtgacacgatctgttgaaaaaatgaatattgagtcagtctaaaacacatgtctcta |
177 |
Q |
| |
|
||| ||||||||||||| ||||||||||||| ||||| |||| ||| ||||||||||||||| |
|
|
| T |
33521566 |
cttggggtgacacgatccgttgaaaaaatgagtattgggtcaatctgaaacacatgtctcta |
33521505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 33521444 - 33521394
Alignment:
| Q |
194 |
agaaaaaagttcttgtatgcttttacatgaccaccttcacttagtataatc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33521444 |
agaaaaaagttcttgtatgcttttacatgaccaccttcacttagtataatc |
33521394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University