View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9003_low_82 (Length: 231)

Name: NF9003_low_82
Description: NF9003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9003_low_82
NF9003_low_82
[»] chr4 (2 HSPs)
chr4 (131-201)||(9364966-9365036)
chr4 (15-67)||(9364839-9364891)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 131 - 201
Target Start/End: Original strand, 9364966 - 9365036
Alignment:
131 attttgagttttgatttcccaaattaatgataagagacatccgatctctatctaaccatgaaaatggacaa 201  Q
    |||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
9364966 attttgagttttaatttctcaaattcatgataagagacatccgatctctatctaaccgtgaagatggacaa 9365036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 9364839 - 9364891
Alignment:
15 tggtgttcgacctcgacccaaaactgacacatatgattacatttaattattta 67  Q
    ||||||||||| | |||  |||| ||||||||||||||||| |||||||||||    
9364839 tggtgttcgacttagacaaaaaattgacacatatgattacaattaattattta 9364891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University