View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9004_high_5 (Length: 271)
Name: NF9004_high_5
Description: NF9004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9004_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 4 - 268
Target Start/End: Original strand, 32326721 - 32326985
Alignment:
| Q |
4 |
agtttggagtttactgttaattgtgtgattctgtgatgtcgttacgtatcaattgtgtccaaaacgtgcatggacggtgatcatcagcaattacatgact |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326721 |
agtttggagtttactgttaattgtgtgattctgtgatgtcgttacgtatcaattgtgtccaaaacgtgcatggacggtgatcatcagcaattacatgact |
32326820 |
T |
|
| Q |
104 |
gtcatgatattgacacctataaattcacttaactgcctacaattgttctggtccatagaaatcacatattaaacatcgagggccatacgatacaatcttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326821 |
gtcatgatattgacacctataaattcacttaactgcctacaattgttctggtccataggaatcacatattaaacatcgagggccatacgatacaatcttg |
32326920 |
T |
|
| Q |
204 |
ctggctaaggtcaaacttagggagttcattttcatagattttggcgttaagcatattgtttcgtt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326921 |
ctggctaaggtcaaacttagggagttcactttcatagattttggcgttaagcatattgtttcgtt |
32326985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University