View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9004_low_14 (Length: 224)
Name: NF9004_low_14
Description: NF9004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9004_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 39 - 208
Target Start/End: Original strand, 36609523 - 36609692
Alignment:
| Q |
39 |
atctttggggctgaggatattattaataccctcaccctctccccatctcttcctatcctacctataacatcttctcaagatcaaaatcaaattaaataca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36609523 |
atctttggggctgaggatattattaataccctcaccctcttcccatctcttcctatccgacctataacatcttctcaagatcaaaatcaaattaaataca |
36609622 |
T |
 |
| Q |
139 |
tgtaatgtaatgatccatcgttatgattttctctttgtattttcagatcattctttcactgtctctatct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36609623 |
tgtaatgtaatgatccatcgttatgattttctctttgtattttcagatcattctttcactttctctatct |
36609692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University