View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_high_42 (Length: 411)
Name: NF9005_high_42
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 394
Target Start/End: Complemental strand, 32953067 - 32952680
Alignment:
| Q |
1 |
aaaattctgcttttgcttaaaaatttaccccaaccttacttttgtggtgaggctacgaattttggttcaatgccagaacannnnnnnnnnnatttggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32953067 |
aaaattctgcttttgcttaaaaatttaccccaaccttacttttgtggtgtggctacgaattttggttcaatgccagaacatttttttttttatttggaaa |
32952968 |
T |
 |
| Q |
101 |
aatatcagtccaaacacagcatgttatctgcactacttgcacgtgtgttaggtccaaacgtggtaatttgtggaatgatatgaccatgtttagtttggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952967 |
aatatcagtccaaacacagcatgttatctgcactacttgcacgtgtgttaggtccaaacgtggtaatttgtggaatgatatgaccatgtttagtttggtg |
32952868 |
T |
 |
| Q |
201 |
tcttttttaagttgttgatggttgttttctagaccccttgcattgctcaaagtcctttggatttagcagtcgtaactcccgatcacacaaaattgggggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32952867 |
tcttttttaagttgttgatggttgttttctagaccccttgcattgctcaaagtcctttggatttagcagt------tcctgatcacacaaaattgggggt |
32952774 |
T |
 |
| Q |
301 |
tacaacccaattgttatgttttggattagagggtggcttccgtcggcttatttcagaggttgattgatctgagtggcttataaagcaatcacat |
394 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32952773 |
tacaacccgatcgttatgttttggattagagggtggcttccgtcggcttatttcagaggttgattgatccgagtggcttataaagcaatcacat |
32952680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University