View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_high_55 (Length: 324)
Name: NF9005_high_55
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_high_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 23 - 311
Target Start/End: Complemental strand, 18911444 - 18911157
Alignment:
| Q |
23 |
atgtttgtactttgtaatcaactcatcacttctcttgctttgctaccattatttttcttctcaatttcagtttcccaggtactcaaatagtgttgcatcc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911444 |
atgtttgtactttgtaatcaactcatcacttttcttgctttgctaccattttttttcttctcaatttcagtttcccaggtactcaaatagtgttgcatcc |
18911345 |
T |
 |
| Q |
123 |
ttgtcttacaaccattcgggacagcttctagctgtagcatcaagttatactttccaagaagcaaaagaaatgtgagtaattcttatacnnnnnnnatttg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18911344 |
ttgtcttacaaccattcgggacagcttctagctgtagcatcaagttatactttccaagaagcaaaagaaatgtgagtaattcttatac-ttttttatttg |
18911246 |
T |
 |
| Q |
223 |
catgaagcatgaagtttaaagtattctggttttgagtccaacctttattttgttcaaatttcaagtgattgcatctcttgctctctgct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
18911245 |
catgaagcatgaagtttaaagtattctggttttgagtccaacctttattttgttcaaatttcaagtgattgcatcgcttgctctttgct |
18911157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University