View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9005_high_59 (Length: 319)

Name: NF9005_high_59
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9005_high_59
NF9005_high_59
[»] chr8 (1 HSPs)
chr8 (20-302)||(30902261-30902543)
[»] chr5 (1 HSPs)
chr5 (56-180)||(9941063-9941187)


Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 20 - 302
Target Start/End: Complemental strand, 30902543 - 30902261
Alignment:
20 gacgacactcccggaaaatgggtcgtctcatcggagtgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30902543 gacgacactcccggaaaatgggtcgtctcatcggagtgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtc 30902444  T
120 atggcttccacgtggcatgtgttgacacgtggcttgggtctcactcttcttgcccttcttgccgtgctccgtttgccgttgctaggtgtcagaaatgtgg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30902443 atggcttccacgtggcatgtgttgacacgtggcttgggtctcactcttcttgcccttcttgccgtgctccgtttgccgttgctaggtgtcagaaatgtgg 30902344  T
220 gctttatcaaccgacggctgccggagaagttgccggtgaaacggaacagaaaactgccggcggcgagaatgtagaagttgttg 302  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30902343 gctttatcaaccgacggctgccggagaagttgccggtgaaacggaacagaaaactgccggcggcgagaatgtagaagttgttg 30902261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 56 - 180
Target Start/End: Original strand, 9941063 - 9941187
Alignment:
56 tgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtcatggcttccacgtggcatgtgttgacacgtggcttg 155  Q
    ||||| |||||| ||||||| ||| ||||||| || ||| | || || ||||| |||||||| ||||| || |||||||| ||| |||| || |||||||    
9941063 tgcgcgatttgtctctcggatttcgccgccggcgatgagatccgtgttcttccacagtgtggacatggttttcacgtggcttgtattgatacatggcttg 9941162  T
156 ggtctcactcttcttgcccttcttg 180  Q
    |||| ||||| ||||| ||||||||    
9941163 ggtcacactcatcttgtccttcttg 9941187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University