View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_high_83 (Length: 250)
Name: NF9005_high_83
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_high_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 31293762 - 31293998
Alignment:
| Q |
1 |
aaattttgaaatttaatgccatagaccatggtactgaattgtcaaatgaaattatgttgttttcaatttcaaactagttgattgatgctgatttttgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31293762 |
aaattttgaaatttaatgccatagaccatggtactgaattgtcaaatgaaattatgttgttttcaatttcaaactagttgattgatgctgatttttgggg |
31293861 |
T |
|
| Q |
101 |
tgctttcatttcttgtccccatgatttatgtaatgaaaggaagaattaatgaaactttatgttgatctattgttaattaggaggtttactgcacaaattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31293862 |
tgctttcatttcttgtccccatgatttatgtaatgaaaggaagaattaatgaaactttatgttgatctattgttaattaggaggtttgctgcacaaattg |
31293961 |
T |
|
| Q |
201 |
ctggctcacagcaatcctatgctgaggtagtttctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31293962 |
ctggctcacagcaatcctatgctgaggtagtttctct |
31293998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 2 - 90
Target Start/End: Original strand, 31293444 - 31293532
Alignment:
| Q |
2 |
aattttgaaatttaatgccatagaccatggtactgaattgtcaaatgaaattatgttgttttcaatttcaaactagttgattgatgctg |
90 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||| |||||||| ||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
31293444 |
aattttgaaatttaatgtcatggaccatgttactttattgtcaagtgaaattataggattttcaatttcaaacatgtagattgatgctg |
31293532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University