View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_high_89 (Length: 238)
Name: NF9005_high_89
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_high_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 10 - 163
Target Start/End: Complemental strand, 21253815 - 21253663
Alignment:
| Q |
10 |
aaaagtgggtatcttatttatttcgggaactaaatcataagtcgacacgtgtccaatcgttggttccaccgtctcttaatagtggttgatcaacttatta |
109 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21253815 |
aaaagtgggtatcttatt-atttcggaaactaaatcataagtcgacacgtgtccaatcgttggttccaccgtctcttaatagtcgttgatcaacttatta |
21253717 |
T |
 |
| Q |
110 |
taagcaatccccaaattcaaatgaactaggacgcaaatccatccaggttcatta |
163 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21253716 |
taagcaatcaccaaattcaaatgaactaggacgcaaatccatccaggttcatta |
21253663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 21253643 - 21253599
Alignment:
| Q |
179 |
ttcctattcctct-agttgaagaaactcaaaagcaagcatgtaat |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21253643 |
ttcctattcctcttagttgaagaaactcaaaagcaagcatgtaat |
21253599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University