View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_100 (Length: 352)
Name: NF9005_low_100
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 5685328 - 5685643
Alignment:
| Q |
18 |
aattttactatgtaggtatttgttgagatattttaataaacgatatcactttaccgagttagctatattcttctcacattgcgtaatttatttgacgggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685328 |
aattttactatgtaggtatttgttgagatattttaataaacgatatcactttaccgagttagctatattcttctcacattgcgtaatttatttgacgggg |
5685427 |
T |
 |
| Q |
118 |
ttagttagatatcatgtgaccggtctatgatcatttgatgtcactagccaaattgaattgatttgttaggataaggattaaatataagcatttattctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685428 |
ttagttagatatcatgtgaccggtctatgatcatttgatgtcactagccaaactgaattgatttgttaggataaggattaaatataagcatttattctca |
5685527 |
T |
 |
| Q |
218 |
tgaattaagcttgcatcgatatctcattgttcatttgcataatatagttttatgtctatgtctcttggtatttggaatgatattaaaaatataatgtgtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685528 |
tgaattaagcttgcatcgatatctcattattcatttgcataatatagttttatgtctatgtctcttggtatttggaatgatattaaaaatataatgtgtg |
5685627 |
T |
 |
| Q |
318 |
atatgtgctcaggaag |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5685628 |
atatgtgctcaggaag |
5685643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University