View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_124 (Length: 319)
Name: NF9005_low_124
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_124 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 20 - 302
Target Start/End: Complemental strand, 30902543 - 30902261
Alignment:
| Q |
20 |
gacgacactcccggaaaatgggtcgtctcatcggagtgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902543 |
gacgacactcccggaaaatgggtcgtctcatcggagtgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtc |
30902444 |
T |
|
| Q |
120 |
atggcttccacgtggcatgtgttgacacgtggcttgggtctcactcttcttgcccttcttgccgtgctccgtttgccgttgctaggtgtcagaaatgtgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902443 |
atggcttccacgtggcatgtgttgacacgtggcttgggtctcactcttcttgcccttcttgccgtgctccgtttgccgttgctaggtgtcagaaatgtgg |
30902344 |
T |
|
| Q |
220 |
gctttatcaaccgacggctgccggagaagttgccggtgaaacggaacagaaaactgccggcggcgagaatgtagaagttgttg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902343 |
gctttatcaaccgacggctgccggagaagttgccggtgaaacggaacagaaaactgccggcggcgagaatgtagaagttgttg |
30902261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 56 - 180
Target Start/End: Original strand, 9941063 - 9941187
Alignment:
| Q |
56 |
tgcgccatttgtatctcggagttcaccgccggtgaagaggttcgggtgcttcctcagtgtggtcatggcttccacgtggcatgtgttgacacgtggcttg |
155 |
Q |
| |
|
||||| |||||| ||||||| ||| ||||||| || ||| | || || ||||| |||||||| ||||| || |||||||| ||| |||| || ||||||| |
|
|
| T |
9941063 |
tgcgcgatttgtctctcggatttcgccgccggcgatgagatccgtgttcttccacagtgtggacatggttttcacgtggcttgtattgatacatggcttg |
9941162 |
T |
|
| Q |
156 |
ggtctcactcttcttgcccttcttg |
180 |
Q |
| |
|
|||| ||||| ||||| |||||||| |
|
|
| T |
9941163 |
ggtcacactcatcttgtccttcttg |
9941187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University