View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_153 (Length: 275)
Name: NF9005_low_153
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_153 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 15608535 - 15608779
Alignment:
| Q |
20 |
tgaaaccctccaattttaaattggatcaaatgtaattgtgatagtgatactattggaagtcctggtatctcctcttgtggggtaatattcaagaaccaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15608535 |
tgaaaccctccaattttaaattggatcaaatgtaattgtgatagtgatgctattggaagtccttgtatctgctcttgtggggtaatattcaagaaccaca |
15608634 |
T |
|
| Q |
120 |
atgctcaattctgaggttgctttgttgaaggtctgggaattgaaaactctttaaccactaagttatcaggtgtaatgagatgcatggaaattgnnnnnnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15608635 |
atgctcaattctgaggttgctttgttgaaggtctgggaattgaaaactctttaaccactaagttatcaggtgtaat-agatgcatggaaattgaaaaaaa |
15608733 |
T |
|
| Q |
220 |
ntgcactcatctttggctgaaaacttactcaatgttagcagtatta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15608734 |
atgcactcatctttggctgaaaacttactcaatgttagcagtatta |
15608779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University