View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_165 (Length: 265)
Name: NF9005_low_165
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_165 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 38 - 247
Target Start/End: Complemental strand, 20068480 - 20068270
Alignment:
| Q |
38 |
tatttcatattcaaatgtacgattgacattatggcgtacagttgaacgatgattgtctattaaaaaatacatttgaacattgatatgttgtcaaccacta |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068480 |
tatttcatattcaaatgtaagattgacattatggcgcacagttgaacgatgattgtctattaaaaaatacatttgaacattgatatgttgtcaaccacta |
20068381 |
T |
 |
| Q |
138 |
ggaagcacattttgactgtcctaatacattctacc-ccttcaaagataaccgtcaaatctttgtggttttatcatgttgtaggtcgaaggcactggatgg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068380 |
ggaagcacattttgactgtcctaatacattccccctccttcaaagataaccgtcaaatctttgtggttttatcatgttgtaggtcgaaggcactggatgg |
20068281 |
T |
 |
| Q |
237 |
gctgctacaag |
247 |
Q |
| |
|
||||||||||| |
|
|
| T |
20068280 |
gctgctacaag |
20068270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University