View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_167 (Length: 264)
Name: NF9005_low_167
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_167 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 43452990 - 43452834
Alignment:
| Q |
1 |
aatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtataactggttctgcatcttcttgtgatatgctagtttgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43452990 |
aatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtgtaactggttctgcatcttcttgtgatatgctagtttgtctg |
43452891 |
T |
|
| Q |
101 |
tctgaagcagtattagactgctgaagtgtcttcatgtctttgttctcaattttttgaaca |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43452890 |
tctgaagcagtattaga---ctgaagtgtcttcatgtctttgttctcaattttgtgaaca |
43452834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University