View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9005_low_168 (Length: 264)

Name: NF9005_low_168
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9005_low_168
NF9005_low_168
[»] chr7 (1 HSPs)
chr7 (1-160)||(43452834-43452990)


Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 43452990 - 43452834
Alignment:
1 aatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtataactggttctgcatcttcttgtgatatgctagtttgtttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||    
43452990 aatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtgtaactggttctgcatcttcttgtgatatgctagtttgtctg 43452891  T
101 tctgaagcagtattagactgctgaagtgtcttcatgtctttgttctcaattttttgaaca 160  Q
    |||||||||||||||||   ||||||||||||||||||||||||||||||||| ||||||    
43452890 tctgaagcagtattaga---ctgaagtgtcttcatgtctttgttctcaattttgtgaaca 43452834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University