View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_172 (Length: 250)
Name: NF9005_low_172
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_172 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 45364233 - 45364117
Alignment:
| Q |
1 |
tctatatggatgattttaattgtaatccccaatatgtgtcacacaccgaactcgccatactggtgacacatatttgtgtttgatactgacaccaacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45364233 |
tctatatggatgattttaattgtaatccccaatatgtgtcacacaccgaacttgtcatactggtgacacatatttgtgtttgatactgacaccaacatat |
45364134 |
T |
 |
| Q |
101 |
gtaattatgttcaatta |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45364133 |
gtaattatgttcaatta |
45364117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 45364077 - 45364043
Alignment:
| Q |
151 |
tgtgtttgtgtcggtgctttaaagggtttaacaat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45364077 |
tgtgtttgtgtcggtgctttaaagggtttaacaat |
45364043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 209 - 240
Target Start/End: Complemental strand, 45364040 - 45364009
Alignment:
| Q |
209 |
gttacttctagatgactgtttttgtctctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45364040 |
gttacttctagatgactgtttttgtctctctg |
45364009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University