View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9005_low_176 (Length: 250)

Name: NF9005_low_176
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9005_low_176
NF9005_low_176
[»] chr3 (3 HSPs)
chr3 (1-117)||(45364117-45364233)
chr3 (151-185)||(45364043-45364077)
chr3 (209-240)||(45364009-45364040)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 45364233 - 45364117
Alignment:
1 tctatatggatgattttaattgtaatccccaatatgtgtcacacaccgaactcgccatactggtgacacatatttgtgtttgatactgacaccaacatat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||    
45364233 tctatatggatgattttaattgtaatccccaatatgtgtcacacaccgaacttgtcatactggtgacacatatttgtgtttgatactgacaccaacatat 45364134  T
101 gtaattatgttcaatta 117  Q
    |||||||||||||||||    
45364133 gtaattatgttcaatta 45364117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 45364077 - 45364043
Alignment:
151 tgtgtttgtgtcggtgctttaaagggtttaacaat 185  Q
    |||||||||||||||||||||||||||||||||||    
45364077 tgtgtttgtgtcggtgctttaaagggtttaacaat 45364043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 209 - 240
Target Start/End: Complemental strand, 45364040 - 45364009
Alignment:
209 gttacttctagatgactgtttttgtctctctg 240  Q
    ||||||||||||||||||||||||||||||||    
45364040 gttacttctagatgactgtttttgtctctctg 45364009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University