View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9005_low_184 (Length: 243)

Name: NF9005_low_184
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9005_low_184
NF9005_low_184
[»] chr3 (1 HSPs)
chr3 (21-230)||(46184327-46184537)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 230
Target Start/End: Complemental strand, 46184537 - 46184327
Alignment:
21 ctcgagactaccagctcgttgttacacgatctaaccaagaaccccgcctatggatccggctactgccatgcaatgttgtcatccgagctgctgcaggcac 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
46184537 ctcgagactaccagctcgttgttacacgatctaaccaagaaccccgcctatggatccggctactgccatgtaatgttgtcatcccagctgctgcaggcac 46184438  T
121 aatgctgacaggaacagcctcaaattaggagccgatgtgctttcttctgctgtcaaaattctgctct-agctcaattgtcattcccagttactattcaac 219  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
46184437 aatgctgacaggaacagcctcaaattaggagttgatgtgctttcttctgctgtcaaaattctgctctaagctcaattgtcattcccagttactattcaac 46184338  T
220 caattctctgc 230  Q
    |||||||||||    
46184337 caattctctgc 46184327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University