View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_184 (Length: 243)
Name: NF9005_low_184
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_184 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 230
Target Start/End: Complemental strand, 46184537 - 46184327
Alignment:
| Q |
21 |
ctcgagactaccagctcgttgttacacgatctaaccaagaaccccgcctatggatccggctactgccatgcaatgttgtcatccgagctgctgcaggcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
46184537 |
ctcgagactaccagctcgttgttacacgatctaaccaagaaccccgcctatggatccggctactgccatgtaatgttgtcatcccagctgctgcaggcac |
46184438 |
T |
 |
| Q |
121 |
aatgctgacaggaacagcctcaaattaggagccgatgtgctttcttctgctgtcaaaattctgctct-agctcaattgtcattcccagttactattcaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46184437 |
aatgctgacaggaacagcctcaaattaggagttgatgtgctttcttctgctgtcaaaattctgctctaagctcaattgtcattcccagttactattcaac |
46184338 |
T |
 |
| Q |
220 |
caattctctgc |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
46184337 |
caattctctgc |
46184327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University