View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_188 (Length: 239)
Name: NF9005_low_188
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_188 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 248408 - 248629
Alignment:
| Q |
17 |
cccttcccctaaaataaaaggaggtgattgagggtggtgtaggataaggatattgagtaagaggaagagaagggtcacccaatcctaaacttaatgaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
248408 |
cccttcccctaaaataaaaggaggtgattgagggtggtataggataaggatattgagtaagagggagagaagggtcacccaatcctaaacttaatgaaag |
248507 |
T |
|
| Q |
117 |
ggatccaaggaaagaaaagaatgtactaggatgaattttgtctaattttgttttggtataccnnnnnnntctcacattacttgaaaaccgaggttacgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
248508 |
ggatccaaggaaagaaaagaatgtactaggatgaattttgtctaattttgttttggtataccaaaaaaatctcacattacttgaaaaccgaggttacgaa |
248607 |
T |
|
| Q |
217 |
cttacgagtaatttataaacac |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
248608 |
cttacgagtaatttataaacac |
248629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University