View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9005_low_196 (Length: 236)
Name: NF9005_low_196
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9005_low_196 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 35680009 - 35680225
Alignment:
| Q |
18 |
aacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggtgccggtttcagagctatagctcctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35680009 |
aacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggcgccggtttcagagctatagctcctg |
35680108 |
T |
 |
| Q |
118 |
attatagaggctacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattcttgatgctcttgc |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
35680109 |
attatagagggtacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattattgatgctctagc |
35680208 |
T |
 |
| Q |
218 |
tatttctaaggtacaca |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35680209 |
tatttctaaggtacaca |
35680225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 35663526 - 35663741
Alignment:
| Q |
18 |
aacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggtgccggtttcagagctatagctcctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||| || |
|
|
| T |
35663526 |
aacgtggtcgtattcctccacggtttcccggagatatggtactcctggcgccaccagatgatagccgtcgccggtgccggtttcagagctattgcttttg |
35663625 |
T |
 |
| Q |
118 |
attatagaggctacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattcttgatgctcttgc |
217 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||| | |
|
|
| T |
35663626 |
attacagaggatacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaatgacctccttgcaattcttgatgctctttc |
35663725 |
T |
 |
| Q |
218 |
tatttctaaggtacac |
233 |
Q |
| |
|
| |||| ||||||||| |
|
|
| T |
35663726 |
tctttccaaggtacac |
35663741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University