View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9005_low_214 (Length: 225)

Name: NF9005_low_214
Description: NF9005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9005_low_214
NF9005_low_214
[»] chr3 (1 HSPs)
chr3 (11-207)||(54537953-54538149)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 207
Target Start/End: Original strand, 54537953 - 54538149
Alignment:
11 tttggtggtgatggagatagcatcaggttgggaaagttgttgctggcgacgcgggtcggagtaaatttcagatattaatgggaaactcggaatacgtgaa 110  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54537953 tttggtggtgatggagatagcatcgggttgggaaagttgttgctggcgacgcgggtcggagtaaatttcagatattaatgggaaactcggaatacgtgaa 54538052  T
111 atatttgggctgctagctgccttactattgggtattgaatgttgttgtcagataaattgaagtcgcattttaattgtactttcaaaatatccatatt 207  Q
    |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54538053 atatttgggctgctagctaccttactactgggtattgaatgttgttgtcagataaattgaagtcgcattttaattgtactttcaaaatatccatatt 54538149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University