View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9006_low_30 (Length: 236)
Name: NF9006_low_30
Description: NF9006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9006_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 10502570 - 10502363
Alignment:
| Q |
15 |
ttacacatcttgatagcttagaatttataaaactcattattgtaataaggtataagcataaacctttataagcaattgatcaatcaagaggttgaagatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10502570 |
ttacacatcttgatagcttagaatttataaaactcattattgtaataaggtataagcataaacctttataagcaattgatcaatcaataggttgaagatc |
10502471 |
T |
|
| Q |
115 |
acatagtttatgaagaagaaatgggggatcacttagagagccattgagaatggccatagctataatcttgttagcagcttctgtgaaatgaatgccatcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10502470 |
acatagtttatgaagaagaaatgggggatcacttagagagccattgagaatggccatagctataatcttgttagcagcttctgtgaaatgaatgccatcc |
10502371 |
T |
|
| Q |
215 |
caactcac |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
10502370 |
caactcac |
10502363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University