View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9008_high_9 (Length: 227)
Name: NF9008_high_9
Description: NF9008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9008_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 22 - 121
Target Start/End: Complemental strand, 48284826 - 48284727
Alignment:
| Q |
22 |
catatattatacattgtctcatatttgtcttataaataagagaccttacatatattattcgatttaaaatgaacagaacgacagcgttttggcaaaacga |
121 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48284826 |
catatattatgcattgtcccatatttgtcttataaatacgagactttacatatattattcgttttaaaatgaatagaacgacagcgttttggcaaaacga |
48284727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 123 - 217
Target Start/End: Complemental strand, 48284690 - 48284596
Alignment:
| Q |
123 |
tgaattctgaactctgattccacnnnnnnngcgcaagtctcagaccgccgccgaccaccgttggcactgcagtgagccgcctcggagcacaggtt |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48284690 |
tgaattctgaactctgattccaccaaaaaagcgcaagtctcagaccgccgccgaccaccgttggcactgcagtgagccgcctcggagcacaggtt |
48284596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University