View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9008_low_30 (Length: 202)
Name: NF9008_low_30
Description: NF9008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9008_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 5 - 185
Target Start/End: Original strand, 6125040 - 6125220
Alignment:
| Q |
5 |
cgagtttcgtgttgagattcgcttgccgcatagccatgtagaacatctatggtatgggattcaggtacggttgtgcagtgtgttcactgtttatgaagtt |
104 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6125040 |
cgagcttcttgttgagattcgcttgccgcatagccatgtagaacatctatggtatgggattcaggtacggttgtgcagtgtgttcactgtttatgaagtt |
6125139 |
T |
|
| Q |
105 |
tgcattccttatagaatttaaaacatatttaatactttaaatgcaatttgaggaaattccttttttaattgttataggagc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6125140 |
tgcattccttatagaatttaaaacatatttaatactttaaatgcaatttgaggaaattccttttttaattgttataggagc |
6125220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University