View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9009_low_39 (Length: 238)
Name: NF9009_low_39
Description: NF9009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9009_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8567724 - 8567945
Alignment:
| Q |
1 |
ttttttgcaatgaggatattcgataattcttattataaaatgaaaattttacatgtttgataaaaaataattcctgttccattaaattcacttgactaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8567724 |
ttttttgcaatgaggatattcgataattcttattataaaatgaaaattttacatgtttgataaaaaataattcctgttccattcaattcacttgactaag |
8567823 |
T |
 |
| Q |
101 |
gaaactcaaacatattgcagagaacctcacaggcttgcgtatcgcactcagatcttgagacccttcatttgtgctcaatatcatggcagagctgattgcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8567824 |
gaaactcaaacatattgcagagaacctcacaggcttgcgtatcacattcagatcttgagacccttcatttgtgctcaatatcatggcagagctgattgcg |
8567923 |
T |
 |
| Q |
201 |
ggggcatttctttcatctgtct |
222 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
8567924 |
ggggcatttctttcgtctgtct |
8567945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 6572243 - 6572281
Alignment:
| Q |
176 |
caatatcatggcagagctgattgcgggggcatttctttc |
214 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6572243 |
caatatcatggcagagctgattgctggagcatttctttc |
6572281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University