View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9009_low_43 (Length: 218)
Name: NF9009_low_43
Description: NF9009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9009_low_43 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 69 - 128
Target Start/End: Original strand, 169673 - 169732
Alignment:
| Q |
69 |
tatgataagtaatagaaaacaatacaattcctttttgaacattatgagattctgacatag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
169673 |
tatgataagtaatagaaaacaatacaattcctttttgaacattatgagattttgacatag |
169732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 31053486 - 31053450
Alignment:
| Q |
20 |
ttggtagcacaaacatagtagaggtacaggaagacat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31053486 |
ttggtagcacaaacatagtagaggtacaggacgacat |
31053450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University