View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9009_low_6 (Length: 624)
Name: NF9009_low_6
Description: NF9009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9009_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 234 - 495
Target Start/End: Complemental strand, 42037940 - 42037678
Alignment:
| Q |
234 |
ggtacccctggggctcaggctgctattttctgtttgttttgtagcactcttgcacaacctctttattttgttaatatatttatctttgccatnnnnnnnt |
333 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42037940 |
ggtacccctggggctcaggctgctactttctgtttgttttgtagcactcttgcacaacctctttattttgttaatatatttatctttgccataaaaaaat |
42037841 |
T |
|
| Q |
334 |
agtaaagtatgaacatgatgcaccttaagaaattgtaaatacttatgcttattatattatcaatactgatgtgta-nnnnnnnaatggcaaacaaagaaa |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42037840 |
agtaaagtatgaacatgatgcaccttaagaaattgtaaatacttatgcttattatattatcaatactgatgtgtattttttttaatggcaaacaaagaaa |
42037741 |
T |
|
| Q |
433 |
tattattgaaaattggaagagaaaagtacaagagttaacaaaactcttaaaacccgtgagtga |
495 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037740 |
tattattgaaaattggaggagaaaagtacaagagttaacaaaactcttaaaacccgtgagtga |
42037678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 153; E-Value: 9e-81
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 42038173 - 42038009
Alignment:
| Q |
1 |
tagaatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaattctcgacagcccattaggtttggtccctctccctgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038173 |
tagaatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaatcctcgacagcccattaggtttggtccctctccctgttc |
42038074 |
T |
|
| Q |
101 |
ccctagggaatgggcaacttccgacgagtagtctggttttggaggttattctcaggtttttggga |
165 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42038073 |
ccctagggaatgggcaacttccgacgggtagtctggttttgtaggttattctcaggtttttggga |
42038009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 547 - 579
Target Start/End: Complemental strand, 42037631 - 42037599
Alignment:
| Q |
547 |
gcaatgatgttggtttatgatgcagattccttg |
579 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42037631 |
gcaatgatgttggtttatgatgcagattccttg |
42037599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University