View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9010_high_4 (Length: 281)
Name: NF9010_high_4
Description: NF9010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9010_high_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 47 - 281
Target Start/End: Original strand, 37599879 - 37600111
Alignment:
| Q |
47 |
aaaattgcacaactgcgacaacaagatttnnnnnnnnnt-tatcatacaggaggccaaagtacgaactaaatggaaatttatatttcaagaaccaaaagg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37599879 |
aaaattgcacaactgcgacaacaagatttaaaaaaaaaaatatcatacaggaggccaaagtgcgaactaaatggaaatttatatttcaagaaccaaaagg |
37599978 |
T |
|
| Q |
146 |
tttattcagacataactgcaaaatttgttgc-aaaaaacaacataatatattaaggaacacaaccacaatggagaagaggcacaattattttttctaatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37599979 |
tttattcagacataactgcaaaatttgttgcaaaaaaacaacata----attaaggaacacaaccacaatggagaagaggcacaattattttttctaatg |
37600074 |
T |
|
| Q |
245 |
gcaatcgaaggatatcactagcaaaacgctacgacac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37600075 |
gcaatcgaaggatatcactagcaaaacgctacgacac |
37600111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University