View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_high_47 (Length: 312)
Name: NF9011_high_47
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 10032032 - 10032316
Alignment:
| Q |
20 |
gttgtgactattgattaacgtattgaacaaggaggttttggaattgtgggaattttgattacattatttcgaaatttgaaattagggttttcagatgaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032032 |
gttgtgactattgattaacgtattgaacaaggaggttttggaattgtgggaattttgattacattatttcgaaatttgaaattagggttttcagatgaaa |
10032131 |
T |
 |
| Q |
120 |
cgaaatagttgttttatgaaatggtgattaaacgtagtgttaaagttgaaatgccgaaattgaaaaggtgtaaattggatgagcctcattgtgaagatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032132 |
cgaaatagttgttttatgaaatggtgattaaacgtagtgttaaagttgaaatgccgaaattgaaaaggtgtaaattggatgagcctcattgtgaagatga |
10032231 |
T |
 |
| Q |
220 |
agaacatgaaggttgttccgggagtcagaagaagcataaagtgaatgggtttaattctgaagtggattttgacacaggttctgct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10032232 |
agaacatgaaggttgttccgggagtcagaagaagcataaggtggatgggtttaatcctgaagtggattttgacactggttctgct |
10032316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University