View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_high_48 (Length: 308)
Name: NF9011_high_48
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_high_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 1219572 - 1219802
Alignment:
| Q |
1 |
gagatgttgactcaacattgtttctacaaaacacgcacagggtttgatttgattcatcaacaatcc-tctatgttaaaactaagacagtgctctggtgac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
1219572 |
gagatgttgactcaacattgtttctacaaaacacgcacaaggtttgatttgattcatcaacaatccctctatgttaaaactaagacagtgctctcgtgac |
1219671 |
T |
|
| Q |
100 |
cccatggtgggggatgatagtgctccgatggccctcaaatcaggtctctgacgacccacgacgatggatgacaatgcttagatgacccatgtggtggcag |
199 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1219672 |
cccatggtgggggatgatattgctctgatggccctcaaatcaggtctctgacgacccacgacgatggatgacaatgcttagatgacccaggtggtggcag |
1219771 |
T |
|
| Q |
200 |
acaacggagctttggcgatatcaacttgtcc |
230 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| |
|
|
| T |
1219772 |
acaacagagttttggcgatatcaacttgtcc |
1219802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University