View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9011_high_64 (Length: 222)
Name: NF9011_high_64
Description: NF9011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9011_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 208
Target Start/End: Original strand, 23466804 - 23467005
Alignment:
| Q |
7 |
cgagtcctttagcaacgtcaattgcaactttatacctcaagttccacgacaagcatccaccaggacgtggacgcctttgcgaatcccttttcgggaaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466804 |
cgagtcctttagcaacgtcaattgcaactttatacctcaagttccacgacaagcatccaccaggacgtggacgcctttgcgaatcccttttcgggaaaat |
23466903 |
T |
 |
| Q |
107 |
ccaacaatctaatgatccatttgatacataatcataaacaaggtacctaggagctgaagaagaattacaatacccaaaaagtctcacaagattcacatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23466904 |
ccaacaatctaatgatccatttgatacataatcataaacaaggtacctaggagctgaagaagaattacaatacccaaaaagtctcacaagattcacatga |
23467003 |
T |
 |
| Q |
207 |
tg |
208 |
Q |
| |
|
|| |
|
|
| T |
23467004 |
tg |
23467005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 205
Target Start/End: Complemental strand, 46789511 - 46789408
Alignment:
| Q |
102 |
aaaatccaacaatctaatgatccatttgatacataatcataaacaaggtacctaggagctgaagaagaattacaatacccaaaaagtctcacaagattca |
201 |
Q |
| |
|
|||||||||||||| ||||| ||||||| | | | ||||||||||| |||||||| | || | |||||||||||| |||||||||||||||||||| | |
|
|
| T |
46789511 |
aaaatccaacaatccaatgaaccatttggaataaactcataaacaagatacctaggtggtgttggagaattacaataaccaaaaagtctcacaagattaa |
46789412 |
T |
 |
| Q |
202 |
catg |
205 |
Q |
| |
|
|||| |
|
|
| T |
46789411 |
catg |
46789408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University